Proteinbiosynthese

Transkription

Bei der Transkription wird aus der DNA ein komplementärer mRNA-Strang gebildet (messengerRNA). Die RNA ist die Ribonukleinsäure. Statt der Desoxyribose ist der Zucker in der RNA die Ribose. In der RNA gibt es nicht die Base Thymin. Statt Thymin enthält die RNA die Base Uracil. Die Transkription besteht aus 3 Phasen, die alle im Zellkern stattfinden. 

5' AACATGGTCGTACGTACGCATGCATTACGATCGTCGATGCGCTAGCTGCCGTACGATCG 3' nicht codogener/sense Strang

5' TTGTACCAGCATGCATGCGTACGTAATGCTAGCAGCTACGCGATCGACGGCATGCTAGC 3' codogener/antisense Strang

5' AUGGUCGUACGUACGCAUGCAUUACGA 3' mRNA

1. Initiation

Die RNA-Polymerase bindet an den Promotor. Dabei handelt es sich um einen Sequenzbereich, der vor dem Gen liegt. Der Promoter ist reich an den Basen Adenin und Thymin. Daher stammt der Begriff TATA-Box. Gleichzeitig öffnet und entwindet die RNA-Polymerase die DNA. Auch die RNA-Polymerase kann nur am 3'-Ende ansetzen. Der mRNA Strang ist also auch 5' nach 3' ausgerichtet.

2. Elongation

Die RNA-Polymerase wandert solange an der DNA und synthetisiert dabei den neuen mRNA-Strang.

3. Termination

Die Termination kann entweder rho-abhängig oder rho-unabhängig erfolgen. 

Bei der rho-unabhängigen Termination veranlasst die Sekundärstruktur der mRNA die Transkription zu stoppen. 

Es gibt bestimmte DNA-Sequenzen, welche die Geschwindigkeit der Polymerase verlangsamen. Der rho-Faktor lagert sich und die mRNA an und wandert am neu gebildeten Strang zur Polymerase. Erreicht er die Polymerase endet die Transkription. Man spricht dann von einer rho-abhängigen Termination.

Der Komplex aus Polymerase, DNA und mRNA löst sich und die mRNA liegt frei vor. 

RNA-Prozessierung

Bei der RNA-Prozessierung wird die mRNA so verändert, dass sie in der Zelle überlebt d.h. nicht abgebaut wird. In vielen Fällen wird die mRNA auch noch leicht verändert.

1. Capping

Die mRNA bekommt eine Kappe am 5'-Ende. Dabei handelt es sich um eine Sequenz aus modifizierten Guanin Nukleotiden. Sie schützt die mRNA vor dem Abbau und dient als Startsignal für die Translation

2. Polyadenylierung

Am 3'-Ende wird ein sog. Poly-A-Schwanz angehängt. Der Schwanz kann aus bis zu 250 Adeninnukleotiden bestehen. Dadurch wird die Lebenszeit der mRNA reguliert. Normalerweise haben mRNAs eine Halbwertszeit von 30-120 Sekunden

3. Editing

Das Editing dient der Proteinvielfalt. Hierbei werden einzelne Basen ausgetauscht. 

4. Splicing

Die mRNA besteht aus Introns und Exons. Exons enthalten die Informationen für die Gene. Sie heißen Exons da sie aus dem Zellkern (lat. ex; aus oder Hinaus) transportiert werden. Die Introns enthalten keine Information. Sie werden aus der mRNA geschnitten und bleiben im Zellkern.

Beim sog. alternativen Splicing (dt. Spleißen), wird variiert welche Exons aus dem Zellkern transportiert werden. Dies dient also auch der Proteinvielfalt und ermöglicht, dass mehrere Proteine auf einem DNA-Abschnitt codiert werden können. 

Translation

Bei der Translation wird die mRNA in ein Protein übersetzt. Sie findet nach der Prozessierung an den Ribosomen statt.

1. Zuerst bindet sich die kleine Untereinheit an den mRNA-Strang und wandert an ihr entlang bis sie auf das Startcodon trifft.

2. Danach bindet die große Untereinheit des Ribosoms an die mRNA. Das Ribosom besitzt 3 Stellen, an denen eine tRNA binden kann. Die Aminoacyl-Stelle, die Polypeptidstelle und die Exit Stelle. 

 

3. Die tRNA bindet an die A-Stelle. Die tRNA ist ein Molekül, welches eine Aminosäure und das dazu passende Anticodon trägt. Das Codon AUG codiert für die Aminosäure Methionin (Met). Das Anticodon zu AUG ist UAC. 

4. Die mRNA geht dann eine Stelle weiter, sodass die tRNA mit Methionin nun an der P-Stelle ist. Die A-Stelle ist wieder frei und kann eine neue tRNA kann binden. Der Zustand ist dann prätranslational.  

 

5. Die tRNA auf der P-Stelle gibt seine Aminosäure ab und geht weiter auf die E-Stelle wo sie das Ribosom verlässt. Die tRNA aus der A-Stelle rückt dann weiter auf die P-Stelle. Der Zustand wird jetzt als posttranslational bezeichnet. 

 

An der P-Stelle beginnt nun die Polypeptidkette zu wachsen. Der Zustand wechselt nun ständig zwischen prätranslational und posttranslational. Dieser Wechsel findet solange statt bis ein Stopcodon erreicht ist. Für dieses Stopcodon gibt es keine Aminosäure und deshalb auch keine tRNA. Die Translation ist damit beendet.  

Beladung der tRNA

Die Beladung der tRNA ist einer der wichtigsten Vorgänge in einer Zelle, denn hier wird der genetische Code in eine Aminosäure übersetzt. Das daran beteiligte Enzym ist die Amino-Acyl-tRNA-Synthetase. 

1. Die Aminosäure bindet mit einem ATP-Molekül an das aktive Zentrum des Enzyms.

2. ATP wird in AMP und 2 Phosphatgruppen umgewandelt. AMP bindet an die Aminosäure. Die Aminosäure ist aktiviert. 

3. Die tRNA mit dem passenden Anticodon bindet an das Enzym. AMP verlässt das Enzym. 

4. Die aktivierte Aminosäure verlässt gebunden an die tRNA das Enzym und ist bereit für die Translation.

logo klein.PNG
logo.PNG
logo.PNG

Weiterführende Literatur

Themen die dich auch interessieren könnten