Moderne Methoden der Gentechnik

Polymerase Ketten Reaktion (PCR)

Die Polymerase Kettenreaktion ist eine der bedeutesten Methoden der Molekularbiologie. Mithilfe der PCR kann man spezifische Sequenzbereiche aus einer geringen Ausgangsmenge an DNA schnell verfielfältigen und für weitere molekularbiologische Tests verfügbar machen. Ohne die PCR wären Projekte wie das Human Genom Projekt in dieser Zeit schaffbar gewesen. Die PCR ist in drei Abschnitte geteilt, die temperaturgesteurt sind. 

1. Denaturierung bei 95°C

Die Wasserstoffbrücken, welche die DNA verbinden sind empfindlich gegenüber Temperatur. Im ersten Schritt der PCR wird der DNA Doppelstrang komplett getrennt. 

2. Primer-Annealing bei 50-70°C

Wie bei der normalen Replikation muss ein Primer an den DNA Strang angebaut werden, damit die Polymerase den Strang replizieren kann. Der Unterschied ist jedoch, dass bei der PCR ein DNA Primer angebaut wird. Dieser muss später dann nicht wie der RNA Primer bei der PCR umgewandelt werden. Die Primer haben eine Länge von mindestens 16 Basenpaaren. Der Primer darf nur an der Stelle bilden, die auch vermehrt werden soll. Bei einer Länge von 16 Basenpaaren ist das der Fall, da diese Sequenz statistisch gesehen nur einmal im menschlichen Genom vorkommt. Die optimale Temperatur für das Primer-Annealing kann unterschiedlich sein. Bei einer zu hohen Temperatur könnte der Primer unspezifisch an Sequenzen im Genom binden, die eine große Ähnlichkeit mit der Zielsequenz haben. Ist die Temperatur zu niedrig, bindet der Primer überhaupt nicht. 

In einem PCR-Ansatz gibt es immer zwei Primer. Einen Primer für jeden Strang. 

3. Polymerisierung bei 72°C

In diesem Schritt erfolgt die Verlängerung der beiden Stränge. Die Polymerase, die hierbei verwendet wird, ist keine menschliche Polymerase. Diese würden bei diesen hohen Temperaturen sofort denaturieren und damit auch ihre Funktion verlieren. Es wird deshalb eine Polymerase aus dem Organismus "Thermus aquaticus"  verwendet. Die sog. Taq-Polymerase bleibt bei diesen Temperaturen stabil.

Diese Vorgänge werden bis zu 42x wiederholt. Dabei können aus einem DNA-Strang mehrere Billionen DNA Stränge entstehen. Die erzeugten DNA Stränge können eine Länge von bis zu 5000 Basenpaaren haben. 

Seit der Entwicklung der PCR in den 1970er und 1980er Jahren wurde die klassische PCR um viele weitere Methoden ergänzt. bei der sog. Realtime-PCR kann die DNA-Konzentration nach jedem Zyklus gemessen werden. Die Realtime PCR wird oft mit der Reverse Transkriptase PCR verwechselt, da beide oft mit RT-PCR abgekürzt werden. Die Reverse Transkriptase PCR ermöglicht keine Messung der DNA-Konzentration nach jedem Zyklus, sondern dabei wird das Enzym "Reverse Transkriptase verwendet. Die Reverse Transkriptase kann RNA in DNA umschreiben. Somit kann auch RNA nachgewiesen werden. 

Primerdesign

Die Primer, welche für eine PCR verwendet werden, müssen designt und dann bei einer Firma bestellt werden. Das muss bei jeder PCR neu geschehen, da sich das Gen, welches man kopieren möchte bei fast jeder PCR ändert. Es ist jedoch ein Fehler nur einen Primer zu designen. Da es 2 Stränge gibt, gibt es einen Forward und einen Reverse Primer. Ein Primer muss gewisse Anforderungen erfüllen, die sich auch immer ändern können. Primer werden folgendermaßen designed:

 5'  ATGCTGCATGCATGTACGTACGTACGTAGTGCAGTGCAGTGACGACGTTGTGTGACC  3'

3'  TACGACGTACGTACATGCATGCATGCATCACGTCACGTCACTGCTGCAACACACTGG  5'

Für jeden DNA-Strang muss ein Primer hergestellt werden. Dabei muss jedoch berücksichtigt werden, dass die Polymerase nur am 3' Ende anfangen kann zu synthetisieren. Der Forward Primer kann leicht abgelesen werden, da dieser den ersten Basen des 5'-3' Stranges entspricht. Der Forward Primer ist also:

 5'  ATGCTGCATGCATGTACGTA  3'

Der Reverse Primer kann nicht direkt abgelesen werden. Er muss zuerst umgeschrieben werden. Dabei handelt es sich um das Ende des 3'-5' Stranges. 

3'  CACTGCTGCAACACACTGG  5'

 

Der Primer muss jedoch noch in die 5'-3' Form umgeschrieben werden. Der Reverse Primer ist also: 

 

 5' GGTCACACAACGTCGTCAC  3'

Weiterführende Literatur

Themen die dich auch interessieren könnten